
Цель исследований - повышение мясной продуктивности крупного рогатого скота аулиекольской и казахской белоголовой пород, разводимых на территории Республики Казахстан, за счет выявления степени сочетаемости генов гипофизарного фактора транскрипции (bPit-1), гормона роста (bGH), рецептора гормона роста (bGHR) и инсулиноподобного фактора роста-1 (bIGF-1). Исследования на наличие однонуклеотидного полиморфизма генов bPit-1, bGH, bGHR и bIGF-1 проводили на группах аулиекольской (n=284, ТОО «Каркын») и казахской белоголовой (n=296, ТОО «Жанабек») пород. Для определения полиморфизмов генов соматотропного каскада у подопытных животных были отобраны пробы крови. ДНК выделяли из крови животных с использованием коммерческого набора «Pure Link Genomic DNA Kits» согласно инструкции изготовителя. Определение генотипов животных проводили методом ПЦР-ПДРФ. На основании проведенных исследований установлено, что для формирования признаков мясной продуктивности, индексов сбитости, костистости, массивности, растянутости, шилозадости в возрасте 18 и 24 месяца ассоциированы диплотипы, в структуру которых входят гены bGH и bIGF-1. Выявлено, что наличие в диплотипах генотипа bGH-AluILL приводит к снижению признаков мясной продуктивности относительно общей выборки, а присутствие генотипа bGH-AluILV - к повышению. Ассоциированные диплотипы, обеспечивающие повышение или снижение признака мясной продуктивности, с возрастом не изменяются. Полученные данные за счет анализа парных сочетаний позволяют выявить большее количество генетических маркеров, что способствует возможности расширить диапазон животных - носителей маркерного генотипа для участия в селекционных программах.

Full Text

Увеличение производства говядины является одной из наиболее важных и сложных проблем аграрной науки и практики [1]. Известно, что большинство признаков продуктивности, имеющих экономическое значение в животноводстве, являются количественными [2, 3]. Существуют гены, которые оказывают влияние на определенный количественный хозяйственно-полезный признак. Некоторые из этих признаков контролируются одним геном, однако большинство из них обычно контролируются несколькими генами и под влиянием факторов окружающей среды [4, 7, 8]. К одним из распространенных потенциальных генетических маркеров мясной продуктивности относят гены гипофизарного фактора транскрипции (bPit-1), гормона роста (bGH), рецептора гормона роста (bGHR) и инсулиноподобного фактора роста-1 (bIGF-1). Ген гипофизарного фактора транскрипции связан со скоростью роста, живой массой, признаками телосложения и качеством мяса у сельскохозяйственных животных [5, 6, 9, 10]. Ген гормона роста участвует в регуляции постнатального роста и стимуляции метаболизма (липидного, белкового, углеводного и минерального). Ген рецептора гормона роста влияет на живую массу и среднесуточный прирост крупного рогатого скота. Учитывая роль вышеуказанных генов в формировании признаков мясной продуктивности, определение их ассоциации с мясными показателями у крупного рогатого скота аулиекольской и казахской белоголовой пород является актуальным. Цель исследований - повышение мясной продуктивности крупного рогатого скота аулиекольской и казахской белоголовой пород, разводимых на территории Республики Казахстан, за счет выявления степени сочетаемости генов гипофизарного фактора транскрипции (bPit-1), гормона роста (bGH), рецептора гормона роста (bGHR) и инсулиноподобного фактора роста-1 (bIGF-1). Задачи исследований - изучить степень влияния сочетаемости гена гипофизарного фактора в транскрипции (bPit-1), гормона роста (bGH), рецептора гормона роста (bGHR) и инсулиноподобного фактора роста-1 (bIGF-1); определить наличие однонуклеотидного полиморфизма генов bPit-1, bGH, bGHR и bIGF-1 на группах аулиекольской (n=284, ТОО «Каркын») и казахской белоголовой (n=296, ТОО «Жанабек») пород. Материалы и методы исследований. Исследования на наличие однонуклеотидного полиморфизма генов bPit-1, bGH, bGHR и bIGF-1 проводили на группах аулиекольской (n=284, ТОО «Каркын») и казахской белоголовой (n=296, ТОО «Жанабек») пород. Экспериментальная часть работы выполнялась в отделе молекулярно-генетических исследований научно-инновационного центра КГУ им. А.Байтурсынова, в рамках проекта грантового финансирования Министерства образования и науки Республики Казахстан № 0115РК01596 «Скрининг на носительство мутаций, детерминирующих развитие наследственных заболеваний, и разработка генетических маркеров для выявления мясной продуктивности племенного крупного рогатого скота отечественной селекции». Для определения полиморфизмов генов соматотропного каскада у подопытных животных были отобраны пробы крови. ДНК выделяли из крови животных с использованием коммерческого набора «Pure Link Genomic DNA Kits» согласно инструкции изготовителя. Определение генотипов животных проводили методом ПЦР-ПДРФ (табл. 1). Таблица 1 Характеристика аллельных вариантов полиморфных генов соматотропного каскада Полиморфизм Нуклеотидные последовательности и температура отжига праймеров Длина амплификата (п.н.) Генотип Длина рестрикта (п.н.) bPit-1-HinFI F: 5′-aaaccatcatctcccttctt-3′, R: 5′-aatgtacaatgtcttctgag-3′, t=56 °С 451 bPit-1-HinFIАА 451 bPit-1-HinFIВB 244, 207 bPit-1-HinFIAВ 451, 244, 207 bGH-AluI F: 5′-ccgtgtctatgagaagc-3′, R: 5'-gttcttgagcagcgcgt-3′, t=64 °С 208 bGH-AluIVV 208 bGH-AluILL 172, 35 bGH-AluILV 208, 172, 35 bGHR-SspI F: 5′- aatacttgggctagcagtgacaatat-3′, R: 5′- acgtttcactgggttgatga -3′, t=60 °С 182 bGHR-SspIYY 182 bGHR-SspIFF 158, 24 bGHR-SspIFY 182, 158, 24 bIGF-1-SnaBI F: 5′-attcaaagctgcctgcccc-3′, R: 5′-acacgtatgaaaggaact-3′, t=64 °С 249 bIGF-1-SnaBIАA 223, 26 bIGF-1-SnaBIАB 249, 223, 26 bIGF-1-SnaBIВВ 249 Число и длину фрагментов рестрикции определяли электрофоретически в агарозном геле при УФ-свете после окрашивания бромистым этидием и анализировали с помощью компьютерной системы гель-документирования. Статистическая обработка данных была выполнена с помощью компьютерных программ «Microsoft Excel» и «Statistica 6.0». Результаты исследований. По результатам генотипирования были составлены 54 возможных парных сочетаний полиморфных генов соматотропинового каскада. Животные с соответствующими парными сочетаниями генотипов были разбиты на соответствующие группы (диплотипы). Мясная продуктивность каждого диплотипа была проанализирована относительно общей выборки по признакам живой массы в возрасте 18 и 24 месяца, а также по индексам телосложения (сбитости, костистости, растянутости, шилозадости и массивности) в возрасте 18 и 24 месяца. Непараметрические характеристики продуктивности диплотипов были представлены в виде медианы и интерквартильного размаха Ме (25%; 75%). В таблице 2 приведены непараметрические характеристики диплотипов, которые ассоциированы с повышенной либо с пониженной живой массой аулиекольской породы в возрасте 18, 24 месяцев. Из данных, приведенных в таблице 2, следует, что в возрасте 18 месяцев у животных аулиекольской породы с повышенной живой массой ассоциировано 3 диплотипа, самый сильный фенотипический эффект наблюдается у диплотипа bGHR-SspIFY-bIGF-1-SnaBIAB. С пониженной живой массой ассоциировано шесть диплотипов, самый низкий уровень живой массы наблюдается для диплотипа bGH-AluILV-bIGF-1-SnaBIBB. Таблица 2 Парные сочетания генотипов, ассоциированные с живой массой животных аулиекольской породы Структура диплотипа n животных Медиана 95% доверительный интервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Живая масса в возрасте 18 месяцев bGH-AluILL-bIGF-1-SnaBIAA 21 327 305 358 305 358 bGH-AluILL-bIGF-1-SnaBIAB 35 352 343 365 329 368 bGH-AluILL-bIGF-1-SnaBIBB 27 329 313 346 305 364 bGH-AluILV-bIGF-1-SnaBIAA 23 402 379 427 375 428 bGH-AluILV-bIGF-1-SnaBIAB 55 386 379 407 378 421 bGH-AluILV-bIGF-1-SnaBIBB 12 407 382 435 383 431 bPit-1-HinFIAB-bIGF-1-SnaBIAB 36 378 377 382 377 385 Общая выборка 237 373 368 377 329 395 Живая масса в возрасте 24 месяца bGH-AluILL-bIGF-1-SnaBIAA 21 376 361 397 361 397 bGH-AluILL-bIGF-1-SnaBIAB 35 389 383 402 381 404 bGH-AluILL-bIGF-1-SnaBIBB 27 379 365 383 346 399 bGH-AluILV-bIGF-1-SnaBIAA 23 462 429 487 423 489 bGH-AluILV-bIGF-1-SnaBIAB 53 436 429 459 427 477 bGH-AluILV-bIGF-1-SnaBIBB 11 467 428 513 432 488 bPit-1-HinFIAB-bIGF-1-SnaBIAB 36 428 427 435 423 436 Общая выборка 230 414 405 423 381 453 Анализ аулиекольской породы по признаку костистости показал, что наиболее костистыми в возрастах 18 и 24 месяца являются животные bGH-AluILL-bIGF-1-SnaBIВB, а наименее - с генотипом bGH-AluILL-bIGF-1-SnaBIАА. Как и в вышеописанных случаях, структурообразующими генотипами являются в основном гены bIGF и bGH, что возможно связано с тем, что они являются практически соседними звеньями соматотропинового каскада. С признаком массивности у животных аулиекольской породы ассоциированы в основном сочетания генов bGH и bIGF-1. Также была выявлена новая ассоциация, а именно сочетание генов bPit-1 и bGH, диплотип bPit-1-HinFIAB-bIGF-1-SnaBIAB ассоциирован с повышенной массивностью. С индексом растянутости ассоциируются парные сочетания генов bGH и bIGF-1.Кроме того, в структуру входит ген bGHR, чего ранее не отмечалось. В таблице 3 отражена структура и характеристика диплотипов, ассоциированных с индексом сбитости. По данным таблицы 3 можно отметить, что, как и в выше описанных случаях, присутствие генотипа bGH-AluILL превращает диплотип в понижающий сбитость животных в возрасте 18 месяцев, а присутствие генотипа bGH-AluILV - превращает диплотип в повышающий сбитость. Можно отметить также, что к возрасту 24 месяца понижающий сбитость эффект генотипа bGH-AluILL видимо ослабляется. Так, диплотипы bGH-AluILL-bIGF-1-SnaBIAA, bGH-AluILL-bIGF-1-SnaBIAB, bGH-AluILL-bIGF-1-SnaBIBB, ассоциированные с пониженной сбитостью у аулиекольских животных в возрасте 18 месяцев, в возрасте 24 месяца среди достоверно понижающих отсутствуют. Таблица 3 Парные сочетания генотипов, ассоциированные с индексом сбитости животных аулиекольской породы Структура диплотипа n животных Медиана 95% доверительныйинтервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Индекс сбитости; возраст 18 месяцев bGH-AluILL-bIGF-1-SnaBIAA 21 81,690 79,592 84,286 79,592 84,286 bGH-AluILL-bIGF-1-SnaBIAB 35 84,028 83,453 84,496 82,313 85,211 bGH-AluILL-bIGF-1-SnaBIBB 27 82,069 80,142 83,453 79,592 84,328 bGH-AluILV-bIGF-1-SnaBIAA 23 91,216 88,514 92,857 86,806 93,243 bGH-AluILV-bIGF-1-SnaBIAB 54 89,340 88,636 90,625 88,194 91,912 bGH-AluILV-bIGF-1-SnaBIBB 12 91,367 88,722 93,750 88,965 93,349 Общая выборка 236 86,047 85,294 87,879 83,453 93,525 Индекс сбитости; возраст 24 месяца bGH-AluILV-bIGF-1-SnaBIAA 23 88,667 85,465 91,045 84,106 92,857 bGH-AluILV-bIGF-1-SnaBIAB 51 86,875 85,567 87,838 84,375 89,655 bGH-AluILV-bIGF-1-SnaBIBB 11 89,313 85,326 94,615 86,842 91,391 bPit-1-HinFIAB-bIGF-1-SnaBIAB 36 85,256 84,138 86,875 84,106 86,998 Общая выборка 228 83,553 82,432 84,106 81,250 93,023 Оценка индекса шилозадости проводилась также, как и других индексов, и диплотипы, значимо повышающие либо понижающие этот признак относительно общей выборки, приведены и описаны в таблице 4. По данным, приведенным в таблице 4, можно отметить, что расширяется диапазон структурообразующих генов. Так, к ассоциированным с индексом шилозадости у аулиекольских животных в возрасте 18 месяцев добавляется ген bGHR. В частности, присутствие в составе диплотипа генотипа bGHR-SspIFF или bGHR-SspIFY делает его ассоциированным c индексом шилозадости у аулиекольских животных в возрасте 18 месяцев. Однако к возрасту 24 месяца эти диплотипы из списка значимо ассоциированных с индексом шилозадости исчезают. Таблица 4 Парные сочетания генотипов, ассоциированные с индексом шилозадости животных аулиекольской породы Структура диплотипа n животных Медиана 95% доверительныйинтервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Индекс шилозадости; возраст 18 месяцев bGH-AluILL-bIGF-1-SnaBIAA 21 210,000 200,000 218,750 200,000 218,750 bGH-AluILL-bIGF-1-SnaBIAB 35 218,750 218,750 218,750 213,333 220,000 bGH-AluILL-bIGF-1-SnaBIBB 27 211,111 205,882 218,750 200,000 218,750 bGH-AluILV-bIGF-1-SnaBIAA 23 246,154 236,842 253,333 233,333 269,231 bGH-AluILV-bIGF-1-SnaBIAB 55 244,444 237,500 247,059 233,333 250,000 bGH-AluILV-bIGF-1-SnaBIBB 12 248,529 237,500 271,429 239,338 266,964 bPit-1-HinFIAB-bIGF-1-SnaBIAB 36 234,524 233,333 237,500 233,333 244,444 bPit-1-HinFIBB-bGH-AluILL 44 237,500 233,333 246,667 194,444 250,000 Общая выборка 237 228,571 221,053 233,333 194,737 244,444 Индекс шилозадости; возраст 24 месяца bGH-AluILV-bIGF-1-SnaBIAA 23 247,059 233,333 258,824 230,000 261,111 bGH-AluILV-bIGF-1-SnaBIAB 53 238,889 233,333 247,059 231,579 253,333 bGH-AluILV-bIGF-1-SnaBIBB 11 247,368 233,333 277,778 235,714 261,111 bPit-1-HinFIAB-bIGF-1-SnaBIAB 36 233,333 231,579 237,500 231,579 238,194 Общая выборка 230 225,000 222,222 231,579 194,444 235,714 В таблице 5 представлены структуры и непараметрические характеристики диплотипов, ассоциированных с живой массой животных казахской белоголовой породы. По данным таблицы 5 видно, что, как и у животных аулиекольской породы, присутствие в диплотипе генотипа bGH-AluILV повышает живой вес животных в возрасте18, 24 месяца. Исключение составляет диплотип bPit-1-HinFIAB-bGH-AluILV, в состав которого входит ген гипофизарного фактора роста. Присутствие генотипа bPit-1-HinFIAB в данном парном сочетании приводит к снижению живой массы животных в возрасте 24 месяца по сравнению не только с другими диплотипами, содержащими в структуре генотип bGH-AluILV, но и по отношению к общей выборке. С индексом костистости у животных казахской белоголовой породы ассоциированы практически те же диплотипы, что и у аулиекольской. Таблица 5 Парные сочетания генотипов, ассоциированные с живой массой животных казахской белоголовой породы Структура диплотипов n животных Медиана 95% доверительный интервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Живая масса в возрасте 18 месяцев bGH-AluILL-bGHR-SspIFY 23 368 295 341 326 405 bGH-AluILL-bIGF-1-SnaBIBB 53 352 329 367 326 372 bGH-AluILV-bIGF-1-SnaBIAB 15 380 376 405 376 405 bGH-AluILV-bIGF-1-SnaBIBB 31 381 376 395 375 404 bGHR-SspIFY-bIGF-1-SnaBIAB 9 425 413 432 417 425 bGHR-SspIFY-bIGF-1-SnaBIBB 16 428 416 429 417 429 bPit-1-HinFIAB-bGH-AluILV 45 346 326 367 326 373 Общая выборка 297 370 367 372 329 384 Живая масса в возрасте 24 месяца bGH-AluILL-bIGF-1-SnaBIAA 9 374 363 405 363 385 bGH-AluILL-bIGF-1-SnaBIBB 41 382 374 397 342 405 bGH-AluILV-bIGF-1-SnaBIAB 13 456 435 492 435 481 bGH-AluILV-bIGF-1-SnaBIBB 26 447 434 475 431 478 bPit-1-HinFIAB-bGH-AluILV 43 381 374 405 365 423 Общая выборка 257 411 405 420 374 435 Характер влияния генотипа bGH на индекс массивности у казахской белоголовой сохраняется, как и для других индексов, и совпадает с характером влияния у аулиекольских коров. А именно, присутствие генотипа bGH-AluILL превращает диплотип в понижающий массивность животных в возрасте 18, 24 месяца, а присутствие генотипа bGH-AluILV - превращает диплотип в повышающий массивность у животных. В то же время, необходимо отметить, что на массивность животных казахской белоголовой породы повышающий эффект оказывает так же присутствие генотипа bGHR-SspIFY в паре с аллелем bIGF-1-SnaBIB. Необходимо отметить, что структура и перечень диплотипов, ассоциированных с индексом растянутости уживотных казахской белоголовой, совпадает с таковым у аулиекольской выборки. В частности, структурообразующими генами в таких диплотипах являются гены bGH и bIGF-1. Анализ структуры диплотипов, ассоциированных с индексом сбитости, у животных казахской белоголовой породы соответствует таковому у животных аулиекольской породы (табл. 6). Таблица 6 Парные сочетания генотипов, ассоциированные с индексом сбитости у животных казахской белоголовой породы Структура диплотипов n животных Медиана 95% доверительный интервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Индекс сбитости; возраст 18 месяцев bGH-AluILL-bIGF-1-SnaBIBB 53 84,375 83,140 85,326 82,270 87,050 bGH-AluILV-bIGF-1-SnaBIAB 15 89,404 88,636 90,476 88,636 90,476 bGH-AluILV-bIGF-1-SnaBIBB 31 89,474 88,636 90,071 88,235 90,278 bGHR-SspIFY-bIGF-1-SnaBIAB 9 94,512 91,912 100,000 92,199 95,172 bGHR-SspIFY-bIGF-1-SnaBIBB 16 95,595 92,188 98,400 92,522 98,158 Общая выборка 297 86,765 85,475 87,500 83,140 89,744 Индекс сбитости; возраст 24 месяца bGH-AluILL-bIGF-1-SnaBIAA 9 81,457 79,870 84,242 79,894 83,553 bGH-AluILL-bIGF-1-SnaBIBB 41 82,836 81,098 83,889 79,394 84,375 bGH-AluILV-bIGF-1-SnaBIAB 13 89,944 88,636 93,939 88,667 92,121 bGH-AluILV-bIGF-1-SnaBIBB 26 89,543 87,879 91,453 87,586 91,515 Общая выборка 257 85,000 84,242 85,714 81,457 88,816 Из таблицы 6 можно отметить, что, как и в выше описанных случаях, присутствие генотипа bGH-AluILL превращает диплотип в понижающий сбитость животных в возрасте 18 месяцев, а присутствие генотипа bGH-AluILV превращает диплотип в повышающий сбитость. Оценка индекса шилозадости проводилась так же, как и у аулиекольских животных, и диплотипы, значимо повышающие либо понижающие этот признак относительно общей выборки, приведены и описаны в таблице 7. Таблица 7 Парные сочетания генотипов, ассоциированные с индексом шилозадости животных казахской белоголовой породы Структура диплотипов n животных Медиана 95% доверительный интервал Ме Интерквантильный размах ДИ 1 ДИ 2 25% 75% Индекс шилозадости; возраст 18 месяцев bGH-AluILL-bIGF-1-SnaBIBB 53 212,500 205,882 218,750 200,000 227,778 bGH-AluILV-bIGF-1-SnaBIAB 15 244,444 237,500 258,824 237,500 258,824 bGH-AluILV-bIGF-1-SnaBIBB 31 244,444 237,500 253,333 235,714 258,824 bGHR-SspIFY-bIGF-1-SnaBIAB 9 269,231 269,231 284,615 269,231 275,000 bGHR-SspIFY-bIGF-1-SnaBIBB 16 275,000 269,231 280,000 269,231 280,000 общая выборка 297 223,529 220,000 228,571 205,882 250,000 Индекс шилозадости; возраст 24 месяца bGH-AluILL-bIGF-1-SnaBIAA 9 207,143 200,000 218,750 200,000 211,111 bGH-AluILL-bIGF-1-SnaBIBB 41 210,526 206,667 214,286 200,000 220,000 bGH-AluILV-bIGF-1-SnaBIAB 13 253,333 242,857 285,714 243,750 275,000 bGH-AluILV-bIGF-1-SnaBIBB 26 250,000 241,176 271,429 240,000 271,429 общая выборка 257 222,222 218,750 227,778 207,143 244,444 По данным таблицы 7 можно отметить, что у животных казахской белоголовой породы структурообразующими генами для диплотипов, ассоциированных с индексом шилозадости, являются гены гормона роста и инсулиноподобного фактора роста-1, также как и для других индексов, и эти данные совпадают с таковыми у животных аулиекольской породы. Заключение. На основании проведенных исследований оценки ассоциации парных сочетаний генотипов полиморфных генов соматотропинового каскада с признаками мясной продуктивности пород аулиекольской и казахской белоголовой установлено, что формирование признаков мясной продуктивности ассоциировано с живой массой в возрасте 18, 24 месяцев, индексы сбитости, костистости, массивности, растянутости и шилозадости - в возрасте 18 и 24 месяца, ассоциированы диплотипы, в структуру которых входят гены bGH и bIGF-1. Присутствие в таких диплотипах генотипа bGH-AluILL приводит к снижению признаков мясной продуктивности относительно общей выборки, а присутствие генотипа bGH-AluILV - к повышению. Диплотипы, ассоциированные с повышенной или пониженной продуктивностью, сохраняют свою динамику во все возрастные периоды. Проведение анализа парных сочетаний позволяет выявить большее количество генетических маркеров, что способствует увеличению диапазона животных - носителей маркерного генотипа для участия в селекционных программах.


  1. Амерханов, Х. Новый высокорослый зональный мясной тип - Уральский герефорд / Х. Амерханов, Ф. Каюмов, К. Джуламанов // Молочное и мясное скотоводство. - 2008. - №6 - С. 2-10.
  2. Бейшова, И. С. Анализ аллельного состава гена bGH в выборках аулиекольской и казахской белоголовой пород / И. С. Бейшова, Е. В. Белая, В. П.Терлецкий [и др.] // Вопросы нормативно-правового регулирования в ветеринарии. - 2017. - № 1. - С. 117-120.
  3. Белая, Е. В. Комбинированные фенотипические эффекты полиморфных вариантов генов соматотропинового каскада (bPit-1, bPRL, bGH, bGHR и bIGF-1) на признаки молочной продуктивности у крупного рогатого скота голштинской породы / Е. В. Белая, М. Е. Михайлова, Н. В. Батин // Молекулярная и прикладная генетика : сб. науч. трудов. - 2012. - Т. 13. - С. 36-43.
  4. Хлесткина, Е. К. Молекулярные маркеры в генетических исследованиях и в селекции // Вавиловский журнал генетики и селекции. - 2013. - Т.17, №4. - С. 1044-1054.
  5. Aytekin, İ. Associations of Pit-1 gene polymorphism with milk yield and composition traits in brown swiss cattle / İ. Aytekin, S. Boztepe // The Journal of Animal & Plant Sciences. - 2013. - Vol. 23(5). - P. 1281-1289.
  6. Bonfatti, V. Effect of к-casein B relative content in bulk milk к-casein on Montasio, Asiago, and Caciotta cheese yield using milk of similar protein composition / V. Bonfatti, A. Cecchinato, Di Martino [et al.] // Journal of Dairy Science. - 2011. - Vol. 94, № 2. - P. 602-613.
  7. Carsai, C. T. Polymorphism within growth hormone receptor (GHR) gene in Romanian Black and White and Romanian Grey Steppe cattle breeds / C. T. Carsai, A. V. Balteanu, A. Vlaic, O. Chakirou // International Journal of the Bioflux Society. - 2013. - Vol. 5, № 1. - Р. 1-5.
  8. Edriss, Mohammad Ali Association of PIT-1 gene polymorphism with birth weight, milk and reproduction traits in Isfahan Holstein cows / Mohammad Ali Edriss, Vahid Edriss, Hamid Reza Rahmani // Archiv Tierzucht. - 2009. - Vol. 52. - P. 445-447.
  9. Moravčíková, N. HinfI polymorphism of Pit-1 gene in Slovak spotted cattle / N. Moravčíková, А. Trakovická, M. Miluchová [et al.] // Journal of Microbiology, Biotechnology and Food Sciences. - 2013. - Vol.1. - P.1883-1890.
  10. Jakaria, Noor R.R. Identification of a Single Nucleotide Polymorphism at Hinf-1 Enzyme Restriction Site of Pit-1 Gene on Indonesian Bali Cattle Population // Media Peternakan. - 2015. - Vol. 38 (2). - Р. 104 -109.



Abstract - 61

PDF (Russian) - 15


Article Metrics

Metrics Loading ...




  • There are currently no refbacks.

Copyright (c) 2018 Beyshova I.S., Belaya E.V., Baymishev K.B., Traisov B.B.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies